The ATP-binding Cassette Transporter ABCG2 (BCRP) Is Expressed in Human Gastric Carcinoma

WANG Ning, CHEN Lin, WEI Bo, LI Rong, LAN Feng, SHEN Li
WANG Ning, CHEN Lin, WEI Bo, LI Rong, Department of General Surgery, General Hospital of Chinese PLA, Beijing 100853, China

LAN Feng, SHEN Li, Stem Cell Research Center of Peking University, Beijing 100083, China
Supported by the National Natural Science Foundation of China, No. 30570522
Correspondence to: Professor Lin Chen, Department of General Surgery, General Hospital of Chinese PLA, 28 Fuxing Road, Beijing 100853, China.
Email: chenlinbj@vip.sina.com
Telephone: 13693034219 Fax: 010-68217460

Abstract
Aim: To investigate the expression of ABCG2 in human gastric carcinoma and its clinical significance.
Methods: Expression of ABCG2 was examined with immunohistochemical technique in the specimens from 45 gastric carcinoma tissues and 30 surrounding normal tissues. The mRNA expression of ABCG2 was measured by RT-PCR and real-time quantitative PCR in 30 cases of gastric carcinoma and normal gastric mucosa respectively.
Results: ABCG2 expression was observed in 28 of 45 (62.2%) cases by immunohistochemical analysis. In ABCG2-positive tumors, adjacent non-neoplastic tissue was similarly analyzed, revealing that ABCG2 is upregulated in gastric carcinoma. ABCG2 expression in poorly differentiated/undifferentiated carcinoma was significantly higher than that in well/moderately-differentiated carcinoma (P <0.05). The mRNA expression of ABCG2 was significantly higher than that in normal gastric mucosa (P <0.05).
Conclusions: ABCG2 plays an important role in the multi-drug resistance of gastric carcinoma. ABCG2 might be an important factor in the research of gastric cancer stem cell.
Key Words Gastric carcinoma; ABCG2; Multi-drug resistance; side population; Cancer stem cell

INTRODUCTION
Multidrug resistance (MDR) has been recognized as a major cause of failure of gastric carcinoma chemotherapy. Although the concept that cancers arise from “stem cells” or “germ cells” was first proposed about 150 years ago, it is only rencently that advances in stem cell biology have given new impetus to the “cancer stem cell hypothesis.” One of important related concepts of this hypothesis is that even though chemotherapy kills most cells in a tumour, it is believed to leave tumour stem cells behind, which might be an important mechanism of resistance. For example, the ATP-binding cassette (ABC) drug transporter have been shown to protect cancer stem cells from chemotherapeutic agents.[1-4] The human ABCG2 protein is a recently recognized ABC half-transporter, which forms homodimers in the plasma membrane and actively extrudes a wide variety of chemically unrelated compounds from the cells. At the clinics, overexpression of ABCG2 in tumor cells confers cancer multidrug resistance to a variety of newly developed anticancer agents. Additionally, the presence of ABCG2 expression specifically on side-population stem cells, makes ABCG2 an attractive candidate marker for isolation of stem cells with the ability to respond to diverse environmental cues.[5] In contrast, expression of ABCG2 in human gastric carcinoma has not been studied in detail. The aim of this study was to investigate the expression of ABCG2 mRNA and protein in human gastric carcinoma.

MATERIALS AND METHODS
Patients and samples
Surgical specimen from 45 patients with untreated gastric carcinoma were provided for this study. The patients underwent surgery in General Hospital of Chinese PLA in 2006. Samples had been collected by standard procedures at diagnosis before treatment with chemotherapy, fixed in 10% formalin, and then embedded in paraffin wax. At the same time, 30 samples used for total RNA preparation were stored at -80℃ until use.The data on clinicopathologic variables including gender, age, TNM categories and are shown in Table 1. Informed consent was obtained from each patient, and General Hospital of Chinese PLA Committee approved this project prior to the study.

Immunohistochemical analysis of ABCG2 expression
Immunostaining was performed on 4µm paraffin tissue sections mounted on poly-lysine-coated slides and dried at 37℃ overnight. After the slides were deparaffinized in xylene and rehydrated conventionally, the endogenous peroxidase was blocked with 0.3%(v/v)H2O2 in methanol for 30 min. Mouse anti-human ABCG2 monoclonal antibody BXP-21（IgG2a, 1:20）and DAB150-150 Slide Kit were purchased from Chemicon company. Immunostaining was performed on paraffin sections using the standard immunoperoxidase procedure (DAB150-150 Slide Kit).An immunohistochemical protocol to detect ABCG2 was first optimized using normal human placenta as a positive control. Staining with an irrelevant mouse IgG2a was routinely performed as a negative control. The slides were examined and scored independently by two observers without knowledge of clinical information of the patients. If more than 10% of the tumor cells were stained, the samples were considered to be ABCG2-positive carcinoma[6].

Reverse transcription-polymerase chain reaction (RT-PCR)
Total mRNA of human gastric carcinoma was prepared by Trizol (Invitrogen Corporation) according to the procedure of supplier, and the concentration was determined by measuring the absorbance at 260 nm. cDNA was synthesized with 1.5μg of total RNA and random hexadeoxynucleotide primer (Invitrogen Corporation) in a 20μl of a solution containing reverse transcriptase. After synthesis the cDNA was diluted 1:4 with water and stored at -20℃ until use. PCR amplification was carried out by PCR Mix Kit (Fermentas). The PCR cycling parameters were as follows: 5min at 94℃ followed by 37 cycles of 50 s at 94℃, 45 s at 58℃ (GAPDH 56℃ 50 s) and 30 s at 72℃, and a final cycle at 72℃ for 8 min. The PCR primer sequences of ABCG2 and GAPDH, which was used as an internal control, were as follows: for ABCG2, the primer sequence was 5’-CCCGCGACAGTTTCCAATGAAATG-3’and antisense 5’-GGCGTTGAGACCAGGTTTCA-3’. With respect to GAPDH, the primer sequences were as follows: sense primer 5’-GAAGGTGAAGGTCGGA GTC-3’ and antisense primer 5’- GAAGATGGTGATGGGATTTC -3’. PCR products were resolved in 2.0 % agarose gels and visualized by staining with ethidium bromide. To quantify PCR products, the bands representing amplified products were analyzed by Quantity One Analysis Software (BIO-RAD Co. America).

Real-time quantitative PCR
Real-time quantitative PCR (ABI PRISM 7700HT Sequence Detection System) was done using SYBR Green Realtime PCR Master Mix (YOYOBO). The PCR cycling parameters were as follows: 60 s at 95℃ , then 30 s at 95℃, 60s at 60℃, 40 cycles. The PCR primer sequences of ABCG2 and GAPDH were as follows: for ABCG2, the primer sequence was 5’-TGGCTTAGACTCAAGCACAGC-3’and antisense 5’ –TCG
TCCCTGCTTAGACATCC-3’, with respect to GAPDH, the primer sequences were as follows: sense primer 5’-GAAGGTGAAGGTCGGAGTC-3’ and antisense primer 5’- GAAGATGGTGATGGGATTTC-3’. Each sample was tested twice in triplicate. Real-
time quantitative PCR was done using GAPDH for normalization.The relative gene expression of ABCG2 was calculated using the comparative 2- ΔΔCT method[7].

Statistical analysis
All data were disposed by SPSS11.5 statistical software. The relationship between ABCG2 expression and potential explanatory variables, including gender, pT category and pN category was determined by chi-square test. Two-sided P values were calculated and were considered significant when less than 0.05.

RESULTS
ABCG2 expression in human gastric carcinoma
To examine the expression of ABCG2 at the protein level in human gastric carcinoma, we performed immuohistochemical analysis using a monoclonal antibody against ABCG2. As shown in Fig. 1 A,C, ABCG2 expression was observed in the cytoplasm and plasmalemma of gastric carcinoma cells. A negative control did not reveal ABCG2 protein (Fig. 1D). Furthermore, ABCG2 immunoreactivity was detected as a characteristic granular cytoplasm and plasmalemma staining in carcinoma cells (Fig. 1 A,C). ABCG2 protein was not detectable or relatively week staining in normal gastric epithelial cells (Fig. 1B). ABCG2 expression was determined in 28 of all 45 examined cases (62.2%). In contrast, for ABCG2, on the normal gastric epithelial cells control, only two of 30 (6.7%) relatively week staining was observed. The positive expression rate of ABCG2 in gastric carcinoma was 62.2%, and significant higher than that in normal gastric mucosa (6.7%) (P＜0.05).


Fig.1 Immunohistochemical staining of gastric carcinoma specimens using antibodies
to ABCG2 in paraffin sections. (A) ABCG2-positive adenocarcinama stained
with anti-ABCG2 monoclonal antibody (×100). (B) Normal gastric mucosa
(×100). (C) ABCG2 poorly differentiated adenocarcinoma. (D) A negative
control in the serial section of C (×100).


Relationship between ABCG2 expression and clinicopathologic variables in human gastric carcinoma

We examined the relationship between clinicopathologic variables and ABCG2 expression. ABCG2 exression level was independent of age, tumor size, pT and pN category (Table 1.). Concerning degree of differentiation, ABCG2 positivity in pooly differentiated/undiffurentiated carcinoma was significantly higher than that in well/moderately differentiated carcinoma (P=0.036)


Expression of ABCG2 mRNA
Agarose gel electrophoresis showed a 171bp ABCG2 and a 216 bp GAPDH fragment by RT-PCR amplification from gastric caner specimens and normal gastric mucosa (Figure2). The results of Real-time PCR (Figure3) and RT-PCR correlated with each other in the examined cases. The expression level in tumor was much higher than that in normal gastric mucosa (P<0.01).


Fig.2 ABCG2 gene expression in human gastric carcinoma. Expression of ABCG2 and GAPDH gene in 30 patients with gastric carcinoma and surrounding normal tissues was determined by RT-PCR. Data were expressed relative to the expression of GAPDH gene in each gastric carcinoma. (1,3 gastric carcinoma; 2,4 normal gastric mucosa)



Fig.3 ABCG2 gene expression in human gastric carcinoma. Expression of ABCG2 mRNA was measurede by real-time quantitative PCR △CT=ctGAPDH-ctABCG2 (1,3 gastric carcinoma; 2,4 normal gastric mucosa)

DISCUSSION
The ATP-binding Cassette Transporter ABCG2 (BCRP) was identified as the most recent member of ABC drug efflux membrane transporters. ABCG2 (BCRP) was first cloned by Deyle et al[8]. ABCG2 belongs to the G-branch of the superfamily of the ABC transporters. It is a 655 anmino acid peptide with an ability to extrude a wide variety of chemical compounds from the cells. The overexpression of ABCG2 was observed in certain drug-resistant cell lines and tumors, such as leukemia, breast carcinoma and colon carcinoma[9-11], providing a special multidrug resistant phenotype in these cancer cells. ABCG2 was shown to confer resistance against various, clinically relevant compounds, e.g., mitoxantrone, methotrexate, topotecan, SN38, and flavopiridol[5]. Now our present study provides the evidence of frequent ABCG2 expression in human gastric carcinoma in detail. ABCG2 might play an important role in the multi-drug resistance of gastric carcinoma.

The expression of ABCG2 in poorly or undifferentiated carcinoma is significantly higher than that in well/moderately differentiated gastric carcinoma (Table 1). Further ABCG2 protein in carcinoma is much higher than that in adjacent non-neoplastic epithelium (Fig.1). This suggest that the expression level of ABCG2 is very low or non-existent in normal gastric epithelium. These findings raise the possibility that ABCG2 might be involved in transformation of a normal differentiated cell to a malignant tumor cell. Of especial interest is the finding that the expression of ABCG2 is more frequent in poorly/undifferentiated carcinoma , that are usually more refractor to therapy. Therefore, analysis of ABCG2 expression will be available for the choice of anti-cancer agents.

The discovery of cancer stem cells in solid tumors has changed our view of carcinogenesis and chemotherapy. Based on the tumour-stem-cell concept, an alternative model posits that the cancer stem cells are naturally resistant to chemotherapy through their quiescence and ABC-transporter expression. As a result, at least some of the tumour stem cells can survive chemotherapy and support regrowth of the tumour[12]. One particularly intriguing property of stem cells is that they express high levels of specific ABC drug tansporters. For example, haematopoietic stem cells express high levels of ABCG2, but the gene is turn off in most committed progenitor and mature blood cells[13]. Now that we demonstrated that ABCG2 was overexpression in human gastric carcinoma, we can presume if there are a subset of gastric cancer stem cells. In addition, the recent search for new markers of cancer stem cell has identified that ABCG2 was responsible for the “side population” phenotype of stem cells[14-16]. Therefore, we examined the expression of ABCG2 in human gastric carcinomas , in order to raise the possibility that ABCG2 could be an important factor in the research of gastric cancer stem cell and there might be SP stem cells in gastric carcinoma. Further studies should be required to determine whether SP analysis could be used to prospectively identify gastric stem cells.

REFERENCES
1. Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, carcinoma, and cancer stem cells. Nature 2001; 414: 105-111 [PMID: 11689955]
2. Dean M, Fojo T, Bates S. Tumour stem cells and drug resistance. Nat Rev Cancer,2005,5(4):275-284 [PMID: 15803154]
3. Donnenberg VS, Donnenberg AD. Multiple drug resistance in cancer revisited: the cancer stem cell hypothesis. J Clin Pharmacol, 2005,45(8):872-877 [PMID: 16027397]
4. Wicha MS, Liu S, Dontu G. Cancer stem cells: An old idea-A paradigm shift. Cancer Res. 2006 ,66(4):1883-1890 [PMID: 16488983]
5. Sarkadi B, Ozvegy-Laczka C, Német K, Váradi A. ABCG2- a transporter for all seasons. FEBS Lett. 2004, 567(1): 116-120 [PMID: 15165903]
6. Diestra JE, Scheffer GL, Izquierdo MA, et al. Frequent expression of the multi-drug resistance-associated protein, BCRP/MXR/ABCP/ABCG2 in human tumours detected by the BXP-21 monoclonal antibody in paraffin-embedded material. J Pathol. 2002, 198 (2): 213-219 [PMID: 12237881]
7. Kenneth J. Livak, Thomas D. Schmittgen. Analysis of Relative Gene Expression Data Using Real-time Quantitative PCR and the 2-△△CT Method. Methods.2001, 25:402-408 [PMID: 11846609]
8. Doyle LA, Yang W, Abruzzo LV, et al. A multidrug resistance transporter from human MCF-7 breast cancer cells. Proc Natl Acad Sci U S A, 1998,95:15665 [PMID: 9861027]
9. Steinbach D, Sell W, Voigt A, et al. BCRP gene expression is associated with a poor response to remission induction therapy in childhood acute myeloid leukemia. Leukemia, 2002; 16(8):1443-1447 [PMID: 12145683]
10. Van den Heuvel-Eibink MM, Wiemer EA, Prins A, et al. Increased expression of the breast cancer resistance protein (BCRP) in relapsed or refractory acute myeloid leukemia(AML). Leukemia, 2002; 16(5):833-839 [PMID: 11986944]
11. Abbott BL, Colapietro AM, Bames Y, et al. Low levels of ABCG2 expression in adult AML blast samples. Blood, 2002;100(13):4594-4601 [PMID: 12393637]
12. Staud F, Pavek P. Breast cancer resistance protein (BCRP/ABCG2). Int J Biochem Cell Biol, 2005, 37(4):720-725 [PMID: 15694832]
13. Scharenberg, C.W., Harkey, M.A.＆ Torok-Storb, B. The ABCG2 transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by immaturre human hematopoietic progenitors. Blood, 2002;99:507-512 [PMID: 11781231]
14. Bunting KD. ABC transporters as phenotype markers and functional regulators of stem cells. Stem Cells, 2002, 20:11-20 [PMID: 11796918]
15. Setoguchi T, Taga T, Kondo T. Cancer stem cells persist in many cancer cell lines. Cell Cycle, 2004, 3(4):414-415 [PMID: 15004528]
16. Hadnagy A, Gaboury L, Beaulieu R, Balicki D. SP analysis may be used to identify cancer stem cell populations. Exp Cell Res, 2006; 312:3701-10. [PMID: 17046749]